Counting DNA Nucleotides
Problem
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of a length 21 DNA string (whose alphabet contains the symbols ‘A’, ‘C’, ‘G’, and ‘T’) is “ATGCTTCAGAAAGGTCTTACG.”
Given: A DNA string s of length at most 1000 nt.
Return: Four integers (separated by spaces) counting the respective number of times that the symbols ‘A’, ‘C’, ‘G’, and ‘T’ occur in s.
Sample Dataset
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
Sample Output
20 12 17 21
Solution
with open('rosalind_dna.txt', 'r') as f:
dna = f.read().strip()
# Or you could directly copy the input string and paste it as a variable
# Method 1 using dictionary
nucleotide_count = {'A': 0, 'C': 0, 'G': 0, 'T': 0}
for n in dna:
nucleotide_count[n] += 1
print(nucleotide_count['A'], nucleotide_count['C'], nucleotide_count['G'], nucleotide_count['T'])
# If you're unfamiliar with dictionaries, you can just use 4 variables to store the count of each nucleotide
A, C, G, T = 0, 0, 0, 0
for n in dna:
if n == 'A':
A += 1
elif n == 'C':
C += 1
elif n == 'G':
G += 1
elif n == 'T':
T += 1
# Method 2 using count() method
print(dna.count('A'), dna.count('C'), dna.count('G'), dna.count('T'))